Revision history of "Yurttas/PL/OOL/Cplusplus/F/07/03/02/01/00/dna-02.txt"

Jump to navigation Jump to search

Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

  • curprev 00:10, 7 November 2013MassBot1 talk contribs 1,147 bytes +1,147 Created page with "<syntaxhighlight lang="text" line start="1" enclose="div">gcgggatggcaatgagcgggacagcagtgagccccgggatgagggtggag ggcgcaagaggcctgtccctgatccagacctgcagcgccgggcagggtca gggacaggggttg..."